Sample Quiz    

    1. What are the three parts of nucleotide?
    2. Use the base-pairing rule, write the complementary strand for the following DNA strand:       
      DNA strand:  A-C-C-G-T-G-A-T-C 
      Complementary Strand:
    3. Which bases are purines? Pyrimidines? 
    4. Define the following terms: 
      1. Transcription
      2.  Translation
      3. Stop codon and start codon
      4. Central dogma
      5. DNA replicaton
    5. How many amino acids can be encoded by the following base sequences?  
      TACTTTAGAGGACCAGTAATT
    6. What do you mean by term “Double helix”?

    Sample Question Paper   II (Multiple Choice Type)

    1. In which of the following processes does the DNA unzip? 
      1. Transcription and translation
      2. Transcription and replication
      3. Replication and translation
      4. All of these.
      5. None of these.
    2. Which DNA strand can base pair to the following DNA strand?
      A -T- G -C -T- A
      1. T-A-C-G-A-T
      2. A-T-G-C-T-A
      3. U-A-C-G-A-U
      4. A-U-G-C-U-A
    3. Which of the following nucleotide chains could be part of molecule of RNA?     
      1. A-T-G-C-C-A  
      2. A-A-T-A-A-A
      3. G-C-C-T-T-G
      4. A-U-G-C-C-A
    4. A Protein is assembled amino acid by amino acid during the process of……………
      1. Replication
      2. Translation
      3. Transcription
      4. Mutation
    5. Ribosomes:
                                                                                       
      1. Transcribe the DNA code onto messenger RNA
      2. Binds the anticodons of the transfer RNA
      3. Transports the message from the nucleus to the cytoplasm
      4. Acts as a vice to hold the manufacturing apparatus together while the protein is being made.
    6. The DNA                                                                                              
      1. Contains the same amount of adenine as thymine
      2. Contains the same amount of cytosine as guanine
      3. One strand dictates the composition of the opposite strand.
      4. Carries the message from the nulceus to the cytoplasm for protein synthesis.
      5. a, b ,c are correct.
      6. c, d are correct.
      7. a,b, d are correct.
    7. The Nucleotides in a DNA consist of:                                          
      1. a simple sugar; a phosphate group; an organic base
      2. a simple sugar and a phosphate group
      3. a phosphate group and a organic base
      4. a phosphate group, a protein, and a simple sugar.
    8. The organic bases in nucleic acids:                                                 
      1. are the same for RNA and DNA.
      2. Occurs in random amounts in RNA and DNA
      3. Are joined by hydrogen bonds on the interior of the double helix.
      4. carry the genetic code.
      5. c and d are correct.
      6. a and b are correct.
    9. Which of the following mRNA codons would cause synthesis of a protein to terminate?
      1. G-G-G
      2. U-A-C
      3. U-A-G
      4. A-A-G
    10. The discovery of restriction enzymes was important in the   development of recombinant DNA technology because the restriction enzymes:
      1. Can cut DNA in to small fragments that may be inserted into the host DNA.
      2. Can act as vectors and insert foreign DNA in to the host.
      3. Edit mRNA to produce final protein.
      4. Cut DNA at specific nucleotides so that complementary DNA may be added at a known point.
    11. If you consider the making of a protein to cooking, which molecule is the cook?
      1. mRNA
      2. DNA
      3. t-RNA
      4. RNA Polymerase
      5. Ribosomes
    12. GM crops are important:  
      1. As they can feed the poor and needy populations.
      2. As they can contribute in improving the economies of developing nations.
      3. As they can help farmers save money and increase their profit margins.
      4. As they can cause lower food prices.
      5. All are correct.
      6. (a) and (d) are incorrect.
    13. The following can be used as vectors:     
      1. Viruses
      2. Plasmids
      3. Chloroplasts
      4. Mitochondria
      5. a and b are correct
      6. all are correct
      7. all are incorrect.
    14. Translation:                                                                                         
      1. is the process of translating the DNA code from the DNA.
      2. Is accomplished by RNA polymerase.
      3. Requires ribosomes.
      4. Requires removal of nucleosomes.
    15. The process of gel electrophoresis separates …………….fragments by using an electric field.
      1. DNA
      2. Cell
      3. Gel
      4. Enzymes
    16. In Agarose gel electrophoresis DNA is visualized in the gel by staining with    

      1. ethydium bromide using UV illuminator.
      2. Ethylene oxide using UV illuminator.
      3. Alcohol using UV illuminator.
      4. None of the above.
    17. Grapple and Lemato are the examples of   
      1. Hybrid foods
      2. Viruses
      3. Vectors
      4. Mutants
    18. In the fermentation of leavened bread by yeast, the bread rises due to:
      1. Carbon dioxide
      2. Water
      3. None of the above
      4. Oxygen
    19. The soaking of vegetables in the brine, while making “Kimchi” helps to
      1. eliminate possible harmful organisms.
      2.   leave the halotolerant organisms to carry out fermentation.
      3. Add flavor to Kimchi.
      4. All are correct.
    20. The use of soapy detergent in the extraction of DNA helps to 
      1.  break down the cell membrane by dissolving the fatty molecules.
      2. add charges to the DNA molecule.
      3. neutralize the charges on the DNA molecule.
      4. None of the above.
    21. In Agarose gel electrophoresis, the DNA    
      1. migrates to the negative electrode.
      2. migrates to the positive electrode.
      3. breaks down in small molecules.
      4. a, b, c are correct.
      5. All a, b, c are wrong.
    22. Biotechnology has applications in : 
      1. Animal and human health
      2. Genetic counselling
      3. Forensic medicine
      4. All of the above
      5. Only (a) and (c)
    23. Which of the following is related with genetic engineering?
      1. Mitochondria
      2. Golgi apparatus
      3. Plasmids
      4. Lysosomes
    24. Recombinant DNA:        
      1. Is defined as a mix of human and animal DNA
      2. Is required for human cloning
      3. Is required for repairing damaged DNA
      4. Contains a segment of DNA from a foreign source.
    25. Restriction enzymes :
      1. Cut the DNA so as to create sticky ends         (1)
      2. Dissect DNA at specific nucleotide sequences
      3. All of the above are correct
      4. None of the above are correct
    26. To make Transgenic plants, one can use             
      1. Agrobacterium tumefaciens
      2. A particle gene gun
      3. An injection of enzyme
      4. Only (a) and (b) are correct
      5. Only (b) and (c) are correct
    27. Which raw material is used in fermentation process of making beer?
      1. Sugar in fruits
      2. Protein in pulses
      3. Starch in cereals
      4. Starch in vegetables
    28. Which of the following is not an antibiotic?
      1. Aflatoxin
      2. Penicillin
      3. Chloromycin
      4. Streptomycin
    29. Who grants a patent?
      1. Local body
      2. State government
      3. Legal system
      4. Central Government
    30. Which of the following is used as biological warfare agent?
      1. Small pox virus
      2. Bacillus anthracis
      3. Both of these
      4. None of these
    31. Biopatents are awarded for the following
      1. Cell lines
      2. DNA sequences
      3. Strains of microorganisms
      4. All of these
    32. Which of the following is included under Intellectual Property rights?
      1. Copy rights
      2. Patents
      3. Plant breeder rights
      4. All of these
    33. What rights does a patent holder have?
      1. Right to make
      2. Right to use
      3. Right to export
      4. All of these.
    34. The criteria for a patent are
      1. Utility
      2. Inventiveness
      3. Novelty
      4. All of these
    35. The enzyme used for alcohol formation by fermentation is
      1. lipase
      2. zymase
      3. amylase
      4. invertase
    36. Complete the concept map by using the following vocabulary  terms:
      Transfer RNA,  codons,  messenger RNA,  transcription,  translation, ribosomal RNA.
Copyright © 2009 Biotechnology | SEO Optimization by Concern Infotech